Online BLAST

• Search a virtual peptide sequence (ACDEFGHI) against the NCBI NR database.
• Search a virtual random peptide sequence (ADIMWQVRSFCYLGHTKEPN) against the NCBI NR database
• Search a virtual DNA sequence (ACGTACGTACGTACGTACGT) against the NCBI NR database
• Search the delta sleep-inducing peptide DSIP_RABIT against the NCBI NR database.
• Search PPF-1 protein sequence PPF1_PEA against the Swiss-Prot database.
• Search the rice histidine transporter Q85V22_ORYSI against the NCBI plants database.
• Search the rice histidine transporter Q85V22_ORYSI against the NCBI NR database.
• Search the universal stress protein Y577_METJA against the NCBI NR database.
• Search the SAP domain-containing ribonucleoprotein SARNP_HUMAN against the NCBI NR database
• Search olfactory receptor protein OR6C1_HUMAN against the NCBI NR database

Local BLAST

• Construct a local Blast database with hemoglobin alpha subunit protein sequences retrieved from Swiss-Prot and do Blast search locally with a query sequence 209 HBA
• Build local BLAST database for maize transcription factors ZMTF CDS and ZMTF PEP
• Make BLASTN search to find SBP TFs in maize using Arabidopsis SPL3 coding sequence SPL3 CDS
• Make BLASTP search to find SBP TFs in maize using Arabidopsis SPL3 protein sequence SPL3 PEP