Applied Bioinformatics Course

Online BLAST

• Search a virtual peptide sequence (ACDEFGHI) against the NCBI NR database.
• Search a virtual random peptide sequence (ADIMWQVRSFCYLGHTKEPN) against the NCBI NR database
• Search a virtual DNA sequence (ACGTACGTACGTACGTACGT) against the NCBI NR database
• Search the delta sleep-inducing peptide (Swiss-Prot Accession: P01158) against the NCBI NR database.
• Search PPF-1 protein sequence (Swiss-Prot Accession: Q9FY06) against the Swiss-Prot database.
• Search OsHT01 protein sequence (CAD89802) against the NCBI plants database.
• Search OsHT01 protein sequence (CAD89802) against the NCBI NR database.
• Search protein sequence (Q57997) against the NCBI NR database.
• Search cytokine induced protein sequence (NP_149073) against the NCBI NR database
• Search olfactory receptor protein sequence (NP_001005182) against the NCBI NR database

Local BLAST

• Construct a local Blast database with hemoglobin alpha subunit protein sequences retrieved from Swiss-Prot and do Blast search locally with a query sequence [207hba.fasta].
• Construct a local Blast database with hemoglobin beta subunit protein sequences retrieved from Swiss-Prot and do Blast search locally with a query sequence.
• Build local BLAST database for mazie transcription factors [zmtf-mrna.fasta, zmtf-pep.fasta], and do BLAST search to find SBP TFs in maize TFs using seed sequence of the SPL3 DNA binding domain [atsbpd3.fasta].