- Draw a dotplot for a test DNA sequence (ACGTACCAGTACGTATAGTGACGTACCAGTACGTATAGTG) with a tandem repeat, use different word size and compare the results
- Draw a dotplot for a test protein sequence (SENESCENSE), use different word size and compare the results
- Draw a dotplot for the fugu cosmid sequence (AF164138.FAS)
- Retrieve similar regions from AF164138.FAS and draw a dotplot
- Find similar domains from human and mouse carcinoembryonic antigen (CEAM5_HUMAN.FAS, CEAM1_MOUSE.FAS)
- Find the repeat domains from human type 5 carcinoembryonic antigen (CEAM5_HUMAN.FAS)
- Find out the sequence pattern of the drosophila slit protein sequence (SLIT_DROME.FAS) with the online Dotlet web server or the EMBOSS dotmatcher program
- Find the zinc proteinase domain between human MS2 cell surface antigen (ADAM8_HUMAN.FAS) and adamalysin II (VM1A2_CROAD.FAS) from Crotalus adamanteus (Eastern diamondback rattlesnake) venom
- Find special sequence feature of serine-repeat antigen protein precursor (SERA_PLAFG.FAS) using dotplot
- Find special sequence feature of serine/threonine-protein kinase ifkA from Dictyostelium discoideum (IFKA_DICDI.FAS) using dotplot
- Find the special sequence feature of human zinc finger protein (ZN492_HUMAN.FAS)
- Find the special sequence feature of human ubiquitin C
(NP_066289.FAS)
using dotplot
Dotplot
DNA and protein sequence comparison using the dot plot approach.